weebly reliable statistics

Mieux comprendre une maladie génétique grâce à la bioinformatique

(English version)


Mise à jour: janvier 2020

Contexte biologique


L'insuline est une
protéine qui permet au sucre (glucose) de pénétrer dans les cellules des tissus, principalement le tissus adipeux, les muscles et le foie.

Il s'agit d'une hormone qui joue un rôle clé dans la régulation du taux de glucose dans le sang (effet 'hypoglycémiant').
Elle est fabriquée par des cellules spécialisées du pancréas appelées cellules bêta des îlots de Langerhans.
Le diabète de type I (insulino dépendant) est une maladie qui est due le plus souvent à l'absence d'insuline: pour différentes raisons encore mal comprises (virus, auto-immunité, etc.), les cellules du pancréas ne sont plus capables de produire cette protéine.
Le diabète de type II (non insulino dépendant) est la conséquence d'une résistance à l'insuline: pour une même quantité d'insuline, il y a moins de glucose qui entre dans les cellules.
La résistance à l'insuline est favorisée par la sédentarité et l'obésité.

Les causes génétiques du  diabète de  type I et du diabète  de type II ne sont pas encore bien connues. Il s'agit de  maladies dites 'multigéniques':  de nombreux gènes sont concernés (probablement une centaine).

Objectif

Cet atelier, composé de 6 activités, permet de découvrir comment la bioinformatique peut aider à mieux comprendre les causes d'une maladie génétique rare... et à étudier l'insuline de A à Z.


Activité 1: Le gène de l'insuline, les chromosomes et le génome humain

Voici un morceau de la séquence ADN du gène qui code pour l'insuline (séquence 'normale')...
  
     cagccgcagcctttgtgaaccaacacctgtgcggctcacacctggtggaagctctctacc

Question:


(1) Approche bioinformatique: Utiliser l'outil 'BLAT' (UCSC)

Info technique: 'BLAT' est un outil bioinformatique qui permet de comparer une séquence ADN avec la séquence entière d'un génome (soit un texte de 3 milliards de nucléotides pour le génome humain) et de retrouver, si elle existe, celle qui lui ressemble le plus, en quelques secondes. C'est un peu le 'google map' du génome humain

* Copier/coller la séquence ADN dans l'outil 'BLAT'
* Cliquer sur 'submit'
* Page 'BLAT Search Result': Choisir le meilleur score et cliquer sur 'browser'


(2) Approche bioinformatique: utiliser un autre Genome browser: Genome data Viewer (NCBI)

Pour les experts: les gènes sont constitués de régions (séquences ADN) qui vont se retrouver dans le mRNA (exon; ligne verte épaisse)  et de régions  qui ne vont pas se retrouver dans le mRNA (intron; ligne verte fine). Les introns sont éliminés lors de l'épissage, une des étapes clé de la maturation des RNAs.
L'épissage alternatif permet de produire des mRNAs différents: les exons sont gardés ou pas selon les cellules ou selon le stade de développement d'un organisme.

Le gène de l'insuline est composé de 2 exons et 1 intron; les parties vert foncées des exons représentent les séquences ADN qui seront traduites en séquence d'acides aminés.
Il n'y a pas d'épissage alternatif connu pour le gène de l'insuline.


Voici la séquence ADN du gène de l'insuline avec, en rouge, les séquences des 2 exons qui seront traduites en acides aminés:

Activité 2: Comparer les séquences ADN (répertorier les mutations)

Environ 1 nucléotide sur 1000 diffère d'une personne à l'autre, d'un génome à l'autre. Ces différences sont appelées variations ou mutations. Certaines n'ont aucune conséquence, d'autre sont associées avec des maladies génétiques. Les variations qui sont associées avec des maladies génétiques modifient le plus souvent la séquence d'une protéine: cette dernière est alors dysfonctionelle (C'est quoi une mutation?).

En 2008, des chercheurs ont étudié une famille norvégienne dont plusieurs membres sont diabétiques (type I et type II).
Toutes les personnes avec un  diabète de type I de cette famille sont porteuses de la même variation (rs121908261) dans le gène qui code pour l'insuline (Molven et al., 2008)
(C'est quoi une mutation?). Cette mutation n'a été retrouvée que dans une seule autre famille 2 ans plus tard (Meur et al., 2010).

Voici le pédigré de la famille (phénotype et liens de parenté):

 

Question:


Afin de répondre à cette question, les chercheurs ont extrait l'ADN de 8 des membres de cette famille et ont séquencé une partie du gène qui code pour l'insuline.
>1
cagccgcagcctttgtgaaccaacacctgtgcggctcacacctggtggaagctctctacc
tagtgtgcggggaacgaggcttcttctacacacccaagacctgccgggaggcagaggacc
>2
cagccgcagcctttgtgaaccaacacctgtgcggctcacacctggtggaagctctctacc
tagtgtgcggggaacgaggcttcttctacacacccaagacccgccgggaggcagaggacc
>3
cagccgcagcctttgtgaaccaacacctgtgcggctcacacctggtggaagctctctacc
tagtgtgcggggaacgaggcttcttctacacacccaagacctgccgggaggcagaggacc
>4
cagccgcagcctttgtgaaccaacacctgtgcggctcacacctggtggaagctctctacc
tagtgtgcggggaacgaggcttcttctacacacccaagacccgccgggaggcagaggacc
>5
cagccgcagcctttgtgaaccaacacctgtgcggctcacacctggtggaagctctctacc
tagtgtgcggggaacgaggcttcttctacacacccaagacccgccgggaggcagaggacc
>6
cagccgcagcctttgtgaaccaacacctgtgcggctcacacctggtggaagctctctacc
tagtgtgcggggaacgaggcttcttctacacacccaagacccgccgggaggcagaggacc
>7
cagccgcagcctttgtgaaccaacacctgtgcggctcacacctggtggaagctctctacc
tagtgtgcggagaacgaggcttcttctacacacccaagacccgccgggaggcagaggacc
>8
cagccgcagcctttgtgaaccaacacctgtgcggctcacacctggtggaagctctctacc
tagtgtgcggggaacgaggcttcttctacacacccaagacccgccgggaggcagaggacc


Comparer les 8 séquences et localiser la variation dans le gène de l'insuline qui est commune aux personnes diabétiques

Approche papier crayon:
...bandelettes de papier avec les séquences ADN à analyser manuellement afin de bien comprendre le principe de la comparaison de séquence et de l'alignement:


Approche bioinformatique:
Construire un alignement des 8 séquences à l'aide d'un outil bioinformatique et identifier la variation commune aux personnes diabétiques de type I

* Copier/Coller les 8 séquences (inclue la ligne '>1') dans l'outil d'alignement
* Cliquer sur l'icône 'Run align'
* Sur la page des résultats, colonne de droite 'Highlight': sélectionner 'Similarity'

Pour les plus curieux:
....informations médicales sur la famille
Le sujet (1) avec la mutation appelée R55C (hétérozygote) a présenté un diabète de type I à l'âge de 10 ans. Elle avait un taux de glucose dans le sang de 17.6 mmol/l.
Sa maman (3) a développé un diabète de type I à l'âge de 13 ans. Elle est sous traitement d'insuline (...).  Elle est aussi hétérozygote pour la mutation.
Le grand-père maternel (6) a été diagnostiqué diabétique de type II à l'âge de 40 ans. Il est traité à l'insuline (...). Ni lui ni sa femme (en bonne santé) ne sont porteurs de la mutation, ce qui suggère qu'il s'agit d'une mutation de novo qui pourraient avoir eu lieu par exemple dans les cellules germinales d'un des 2 grands-parents (...).
Les patients (1) et (3) porteurs de la mutation ont des taux de C-peptide quasi normaux, ce qui suggère qu'ils sont quand même capables de fabriquer de l'insuline. Les scientifiques ne comprennent pas pourquoi les patients (1) et (3) ont besoin de s'injecter de l'insuline à des doses aussi élevées (...) (Molven et al., 2008).

Pour les experts: voici la localisation sur le génome de la mutation  (rs121908261) G/A (C/T reverse; R55C) retrouvée dans ces 2 familles:
le gène de l'insuline est lu dans le sens 'reverse' (de droite à gauche) par rapport à la séquence du génome de référence: la mutation G ->A est en fait une mutations C->T.



Activité 3: Traduction ADN -> protéine  (interpréter les mutations)

Effet de la mutation sur la séquence de la protéine

L'insuline, comme toutes les protéines, est composée d'une succession d'acides aminés. L'ordre des acides aminés est déterminé par la séquence en acides nucléiques du gène de l'insuline: 3 'lettres ADN' correspondent à un acide aminé (symbolisé par les lettres: K pour lysine, M pour méthionine, etc.)

Voici un morceau de la séquence ADN du gène de l'insuline 'normale'.
aag acc cgc cgg gag 
Voici un morceau de la séquence ADN du gène de l'insuline avec la variation c -> t, associée avec un diabète.
aag acc tgc cgg gag 

Question:


Vous pourriez traduire manuellement les séquences en acide nucléique en séquence en acide aminé (code '1 lettre') en utilisant le code génétique ci-dessous:
 

Vous pouvez utiliser l'outil bioinformatique 'Translate'

Réponse: La mutation c -> t dans le gène de l'insuline conduit au remplacement de l'acide aminé R (arginine; codon cgc) par l'acide aminé C (cystéine; codon cgt) en position 55 de la séquence de la protéine: ce changement empêche la protéine insuline d'être 'coupée', un processus qui est essentiel pour que l'insuline puisse être fonctionnelle (Molven et al., 2008).
L'insuline est coupée par une enzyme appelée 'protéase' ( insulin protease , insulinase) à la position 55. Le site de coupure reconnu par l'insulinase est très spécifique: un changement dans la séquence en acide aminé du site de coupure (comme celui induit par la mutation R55C), empêche la protéase de faire son 'travail'.
 

Pour les experts:
Il existe de nombreuses mutations connues dans la séquence de la protéine insuline, certaines d'entre elles peuvent être responsables de différentes maladies génétiques:
https://www.uniprot.org/uniprot/P01308#pathology_and_biotech

Pour voir, en particulier, la localisation des mutations / variants sur la séquence et/ou la structure 3D de l'insuline:
https://www.uniprot.org/uniprot/P01308/protvista

Activité 4: Visualiser la structure 3D de l'insuline

4. 1 Une séquence en acide aminé vue autrement...

Utiliser l'outil "Pepdraw" , un outil qui permet de 'visualiser'  la structure atomique d'une séquence d'acides aminés: http://pepdraw.com/:
comparer la séquence en acide aminé 'normale' avec la séquence en acide aminé 'mutée'

4.2 Structure 3D de l'insuline

La séquence d'une protéine détermine sa forme (structure 3D) - et sa fonction.
Les chercheurs sont capables (depuis 1958) de cristalliser des protéines et de les 'prendre en photo' à l'aide des rayons X.
Les résultats de ces expériences sont ensuite analysés grâce à des programmes bioinformatiques: on peut ainsi visualiser la structure des protéines... et de l'insuline
(C'est quoi la modélisation moléculaire?)

Visualiser la structure 3D de l'insuline  (PDB 2HIU)
* Sélectionner le viewer '3D visualisation' à droite de la page
* Dans 'Visual setting' 'Polymer properties': choisir différentes représentation : 'cartoon' ou 'ball & stick'
* Dans 'Type properties' choisir ce que vous souhaitez colorer de différentes couleurs
               
   Vue 'Cartoon' (seul le 'backbone' des chaînes A (vert) et B (orange) est visible)                     Vue 'Ball & stick' (les atomes de chaque acide aminé sont visibles); chaque acide aminé a une couleur différente