You are here: Home  >  Education  >  Ateliers de bioinformatique
weebly reliable statistics

La génétique d'un goût amer...

Cet atelier de bioinformatique est un complément à l'activité PCR (sensibilité au PTC) proposée par BiOutils
 

Historique:
Dans les années 30, le chimiste Arthur Fox synthétise le composé PTC (PhénylThioCarbamide), un composé amer produit entre autre par le brocoli.
L’un de ses collègues se plaint de l’amertume du produit alors que lui-même ne sent rien. Il est ainsi le premier à mettre en évidence la différence de sensibilité au PTC au sein de la population.

Quelques années plus tard, une étude menée par Albert Blakeslee (PNAS, 1935) a montré que l’incapacité à sentir le PTC est un trait génétique récessif (plus d'info)

En moyenne, 75 % des individus sont sensibles au goût amer  PTC.
Le séquençage du gène TAS2R38 en 2003 a permis de mettre en évidence les variations génétiques qui sont associées au phénotype 'sensible' et 'non sensible' au PTC.

Remarques:
1) il existe beaucoup d'autres molécules conférant un goût amer... et au moins une trentaine de gènes 'récepteurs'....On parle ici de la génétique du goût amer de la molécule PTC, reconnue par le récepteur TAS2R38....

2) il existe de nombreuses variations génétiques dans la séquence ADN du récepteur TAS2R38, dont certaines  ne sont pas encore connues et pourraient  également affecter le phénotype 'sensible' et 'non sensible' au PTC. Ces variations génétiques additionnelles pourraient expliquer certaines absences de corrélation observées entre le génotype et le phénotype (Chem. Senses, 2013)
3) il semblerait que les variations génétiques associées avec le phénotype 'sensible' et 'non sensible' au PTC soient également associées avec des risques de développer certaines maladies. Des questions éthiques se posent donc...(publication 2015)

Activité 1: Sur quel chromosome est localisé le gène TAS2R38 ?

Voici un morceau de la séquence du gène TAS2R38

 tagtgaagaggcaggcactgagcaacagtgattgtgtgctgctgt

 Approche bioinformatique:

* Copier/coller la séquence ADN dans l'outil 'BLAT'
* Cliquer sur 'submit'
* Page 'BLAT Search Result': Choisir le meilleur score (un match qui couvre la séquence en entier) et cliquer sur 'browser'

          la retrouvez-vous dans notre génome ?  et dans le génomes des autres animaux ?


Activité 2: Identifier les variations génétiques associées avec la sensibilité au PTC

Voici les séquences ADN du gène TAS2R38 de 2 individus qui ne sont pas sensibles au PTC et de 2 individus sensibles au PTC .

>sensible1
     atgttgactc taactcgcat ccgcactgtg tcctatgaag tcaggagtac atttctgttc
     atttcagtcc tggagtttgc agtggggttt ctgaccaatg ccttcgtttt cttggtgaat
     ttttgggatg tagtgaagag gcagccactg agcaacagtg attgtgtgct gctgtgtctc
     agcatcagcc ggcttttcct gcatggactg ctgttcctga gtgctatcca gcttacccac
     ttccagaagt tgagtgaacc actgaaccac agctaccaag ccatcatcat gctatggatg
     attgcaaacc aagccaacct ctggcttgct gcctgcctca gcctgcttta ctgctccaag
     ctcatccgtt tctctcacac cttcctgatc tgcttggcaa gctgggtctc caggaagatc
     tcccagatgc tcctgggtat tattctttgc tcctgcatct gcactgtcct ctgtgtttgg
     tgctttttta gcagacctca cttcacagtc acaactgtgc tattcatgaa taacaataca
     aggctcaact ggcagaataa agatctcaat ttattttatt cctttctctt ctgctatctg
     tggtctgtgc ctcctttcct attgtttctg gtttcttctg ggatgctgac tgtctccctg
     ggaaggcaca tgaggacaat gaaggtctat accagaaact ctcgtgaccc cagcctggag
     gcccacatta aagccctcaa gtctcttgtc tcctttttct gcttctttgt gatatcatcc
     tgtgctgcct tcatctctgt gcccctactg attctgtggc gcgacaaaat aggggtgatg
     gtttgtgttg ggataatggc agcttgtccc tctgggcatg cagccgtcct gatctcaggc
     aatgccaagt tgaggagagc tgtgatgacc attctgctct gggctcagag cagcctgaag
     gtcagagccg accacaaggc agattcccgg acactgtgct ga 
>nonsensible1 
atgttgactc taactcgcat ccgcactgtg tcctatgaag tcaggagtac atttctgttt
atttcagtcc tggagtttgc agtggggttt ctgaccaatg ccttcgtttt cttggtgaat ttttgggatg tagtgaagag gcaggcactg agcaacagtg attgtgtgct gctgtgtctc
agcatcagcc ggcttttcct gcatggactg ctgttcctga gtgctatcca gcttacccac
ttccagaagt tgagtgaacc actgaaccac agctaccaag ccatcatcat gctatggatg
attgcaaacc aagccaacct ctggcttgct gcctgcctca gcctgcttta ctgctccaag
ctcatccgtt tctctcacac cttcctgatc tgcttggcaa gctgggtctc caggaagatc
tcccagatgc tcctgggtat tattctttgc tcctgcatct gcactgtcct ctgtgtttgg
tgctttttta gcagacctca cttcacagtc acaactgtgc tattcatgaa taacaataca aggctcaact ggcagaataa agatctcaat ttattttatt cctttctctt ctgctatctg
tggtctgtgc ctcctttcct attgtttctg gtttcttctg ggatgctgac tgtctccctg
ggaaggcaca tgaggacaat gaaggtctat accagaaact ctcgtgaccc cagcctggag
gcccacatta aagccctcaa gtctcttgtc tcctttttct gcttctttgt gatatcatcc
tgtgttgcct tcatctctgt gcccctactg attctgtggc gcgacaaaat aggggtgatg
gtttgtgttg ggataatggc agcttgtccc tctgggcatg cagccatcct gatctcaggc
aatgccaagt tgaggagagc tgtgatgacc attctgctct gggctcagag cagcctgaag gtaagagccg accacaaggc agattcccgg acactgtgtt ga

>sensible2 atgttgactc taactcgcat ccgcactgtg tcctatgaag tcaggagtac atttctgttc atttcagtcc tggagtttgc agtggggttt ctgaccaatg ccttcgtttt cttggtgaat ttttgggatg tagtgaagag gcagccactg agcaacagtg attgtgtgct gctgtgtctc agcatcagcc ggcttttcct gcatggactg ctgttcctga gtgctatcca gcttacccac ttccagaagt tgagtgaacc actgaaccac agctaccaag ccatcatcat gctatggatg attgcaaacc aagccaacct ctggcttgct gcctgcctca gcctgcttta ctgctccaag ctcatccgtt tctctcacac cttcctgatc tgcttggcaa gctgggtctc caggaagatc tcccagatgc tcctgggtat tattctttgc tcctgcatct gcactgtcct ctgtgtttgg tgctttttta gcagacctca cttcacagtc acaactgtgc tattcatgaa taacaataca aggctcaact ggcagaataa agatctcaat ttattttatt cctttctctt ctgctatctg tggtctgtgc ctcctttcct attgtttctg gtttcttctg ggatgctgac tgtctccctg ggaaggcaca tgaggacaat gaaggtctat accagaaact ctcgtgaccc cagcctggag gcccacatta aagccctcaa gtctcttgtc tcctttttct gcttctttgt gatatcatcc tgtgctgcct tcatctctgt gcccctactg attctgtggc gcgacaaaat aggggtgatg gtttgtgttg ggataatggc agcttgtccc tctgggcatg cagccgtcct gatctcaggc aatgccaagt tgaggagagc tgtgatgacc attctgctct gggctcagag cagcctgaag gtaagagccg accacaaggc agattcccgg acactgtgct ga

>nonsensible2 atgttgactc taactcgcat ccgcactgtg tcctatgaag tcaggagtac atttctgttc atttcagtcc tggagtttgc agtggggttt ctgaccaatg ccttcgtttt cttggtgaat ttttgggatg tagtgaagag gcaggcactg agcaacagtg attgtgtgct gctgtgtctc agcatcagcc ggcttttcct gcatggactg ctgttcctga gtgctatcca gcttacccac ttccagaagt tgagtgaacc actgaaccac agctaccaag ccatcatcat gctatggatg attgcaaacc aagccaacct ctggcttgct gcctgcctca gcctgcttta ctgctccaag ctcatccgtt tctctcacac cttcctgatc tgcttggcaa gctgggtctc caggaagatc tcccagatgc tcctgggtat tattctttgc tcctgcatct gcactgtcct ctgtgtttgg tgctttttta gcagacctca cttcacagtc acaactgtgc tattcatgaa taacaataca aggctcaact ggcagaataa agatctcaat ttattttatt cctttctctt ctgctatctg tggtcagtgc ctcctttcct attgtttctg gtttcttctg ggatgctgac tgtctccctg ggaaggcaca tgaggacaat gaaggtctat accagaaact ctcgtgaccc cagcctggag gcccacatta aagccctcaa gtctcttgtc tcctttttct gcttctttgt gatatcatcc tgtgttgcct tcatctctgt gcccctactg attctgtggc gcgacaaaat aggggtgatg gtttgtgttg ggataatggc agcttgtccc tctgggcatg cagccatcct gatctcaggc aatgccaagt tgaggagagc tgtgatgacc attctgctct gggctcagag cagcctgaag gtcagagccg accacaaggc agattcccgg acactgtgct ga
Comparer ces 4 séquences et localiser les variations qui sont uniquement et systématiquement associées avec la sensibilité au PTC

...vous pouvez le faire manuellement, à l'oeil ou avec l'aide d'acétates (pour les plus motivés, courage...)

Approche bioinformatique:
Construire un alignement des 4 séquences à l'aide d'un outil bioinformatique:

* Copier/Coller les 4 séquences (inclue la ligne '>') dans l'outil d'alignement d'UniProt
* Cliquer sur l'icône 'align'
* Dans la colonne de droite: sélectionner 'Similarity'.

Résultats de l'alignement

Interprétation des résultats et conclusion

Pour aller plus loin....
Répartition de la variation 145 g -> c (appelée 'SNP rs713598') dans la population humaine

Activité 3: De l'ADN aux protéines....


La protéine TAS2R38, comme toutes les protéines, est composée d'une succession d'acides aminés (pdf); (plus d'info))
 
3 'lettres ADN' (un codon) correspondent à 1 'lettre acide aminé' selon le code génétique ci-dessous:
 

Voici les séquences ADN du gène TAS2R38 d'un individu qui n'est pas sensible au PTC et d'un individu sensible au PTC:
>nonsensible1_NonTaster
     atgttgactc taactcgcat ccgcactgtg tcctatgaag tcaggagtac atttctgttt
     atttcagtcc tggagtttgc agtggggttt ctgaccaatg ccttcgtttt cttggtgaat
     ttttgggatg tagtgaagag gcaggcactg agcaacagtg attgtgtgct gctgtgtctc
     agcatcagcc ggcttttcct gcatggactg ctgttcctga gtgctatcca gcttacccac
     ttccagaagt tgagtgaacc actgaaccac agctaccaag ccatcatcat gctatggatg
     attgcaaacc aagccaacct ctggcttgct gcctgcctca gcctgcttta ctgctccaag
     ctcatccgtt tctctcacac cttcctgatc tgcttggcaa gctgggtctc caggaagatc
     tcccagatgc tcctgggtat tattctttgc tcctgcatct gcactgtcct ctgtgtttgg
     tgctttttta gcagacctca cttcacagtc acaactgtgc tattcatgaa taacaataca
     aggctcaact ggcagaataa agatctcaat ttattttatt cctttctctt ctgctatctg
     tggtctgtgc ctcctttcct attgtttctg gtttcttctg ggatgctgac tgtctccctg
     ggaaggcaca tgaggacaat gaaggtctat accagaaact ctcgtgaccc cagcctggag
     gcccacatta aagccctcaa gtctcttgtc tcctttttct gcttctttgt gatatcatcc
     tgtgttgcct tcatctctgt gcccctactg attctgtggc gcgacaaaat aggggtgatg
     gtttgtgttg ggataatggc agcttgtccc tctgggcatg cagccatcct gatctcaggc
     aatgccaagt tgaggagagc tgtgatgacc attctgctct gggctcagag cagcctgaag
     gtaagagccg accacaaggc agattcccgg acactgtgtt ga

>sensible1_Taster atgttgactc taactcgcat ccgcactgtg tcctatgaag tcaggagtac atttctgttc atttcagtcc tggagtttgc agtggggttt ctgaccaatg ccttcgtttt cttggtgaat ttttgggatg tagtgaagag gcagccactg agcaacagtg attgtgtgct gctgtgtctc agcatcagcc ggcttttcct gcatggactg ctgttcctga gtgctatcca gcttacccac ttccagaagt tgagtgaacc actgaaccac agctaccaag ccatcatcat gctatggatg attgcaaacc aagccaacct ctggcttgct gcctgcctca gcctgcttta ctgctccaag ctcatccgtt tctctcacac cttcctgatc tgcttggcaa gctgggtctc caggaagatc tcccagatgc tcctgggtat tattctttgc tcctgcatct gcactgtcct ctgtgtttgg tgctttttta gcagacctca cttcacagtc acaactgtgc tattcatgaa taacaataca aggctcaact ggcagaataa agatctcaat ttattttatt cctttctctt ctgctatctg tggtctgtgc ctcctttcct attgtttctg gtttcttctg ggatgctgac tgtctccctg ggaaggcaca tgaggacaat gaaggtctat accagaaact ctcgtgaccc cagcctggag gcccacatta aagccctcaa gtctcttgtc tcctttttct gcttctttgt gatatcatcc tgtgctgcct tcatctctgt gcccctactg attctgtggc gcgacaaaat aggggtgatg gtttgtgttg ggataatggc agcttgtccc tctgggcatg cagccgtcct gatctcaggc aatgccaagt tgaggagagc tgtgatgacc attctgctct gggctcagag cagcctgaag gtcagagccg accacaaggc agattcccgg acactgtgct ga


Question: Les 3 variations dans l'ADN modifient-elles la séquence de la protéine TAS2R38 ?

- Traduire  manuellement les séquences en utilisant le code génétique (courage...seulement les 5 premiers acides aminés...)

Approche bioinformatique


* Copier/coller les 2
séquences ADN (inclue la ligne '>') dans l'outil 'EMBOSS Transeq'; cliquer sur le bouton vert 'submit'
* Copier/coller les 2 séquences traduites (inclue la ligne '>') dans l'outil d'alignement d'UniProt
   !!!!! enlever le signe '*' qui se trouve à la fin des 2 séquences....
* Cliquer sur l'icône 'align'
* Dans la colonne de droite: sélectionner 'Similarity'.

Réponse: les 3 variations qui modifient le phénotype 'sensibilité au PTC' conduisent à un changement d'acide aminé dans la séquence de la protéine TAS2R38  (résultats)


Activité 4: TAS2R38 est-il spécifique à l'être humain ?


Voici la séquence en acide aminé de la protéine TAS2R38 humaine
MLTLTRIRTVSYEVRSTFLFISVLEFAVGFLTNAFVFLVNFWDVVKRQALSNSDCVLLCL
SISRLFLHGLLFLSAIQLTHFQKLSEPLNHSYQAIIMLWMIANQANLWLAACLSLLYCSK
LIRFSHTFLICLASWVSRKISQMLLGIILCSCICTVLCVWCFFSRPHFTVTTVLFMNNNT
RLNWQIKDLNLFYSFLFCYLWSVPPFLLFLVSSGMLTVSLGRHMRTMKVYTRNSRDPSLE
AHIKALKSLVSFFCFFVISSCAAFISVPLLILWRDKIGVMVCVGIMAACPSGHAAILISG
NAKLRRAVMTILLWAQSSLKVRADHKADSRTLC

Question:

  • Cette protéine est-elle spécifique à l'être humain ?

Approche bioinformatique:
Faire un 'BLAST' contre une banque de données de protéines appelée UniProtKB


Info technique: BLAST est un outil bioinformatique qui permet de comparer la séquence d'une protéine avec des millions d'autres séquences contenues dans les banques de données et de retrouver, si elles existent, celles qui lui ressemblent le plus, en quelques secondes. On peut ainsi rapidement savoir si une protéine existe dans une espèce donnée.

* Copier/coller la séquence dans l'outil 'BLAST'
* Sélectionner 'Database = UniProtKB/Swiss-Prot'
* Cliquer sur le bouton 'BLAST'
* Rechercher les images correspondant au nom latin des différentes espèces sur Google


Le goût amer et l'évolution....

  • Les herbivores doivent pouvoir manger un maximum de végétaux différents, même les plus amers. Ils sont de façon générale moins sensibles au goût amer que les omnivores: ils possèdent moins de gènes 'sensibles' à l'amertume....
  • Il semblerait que le chimpanzé soit sensible au goût amer du PTC....
  • Il semblerait que l'on retrouve plus d'individus sensibles au goût amer parmi les non fumeurs....
  • Une étude récente a montré que les adolescents en surpoids sont généralement  moins sensibles aux différents goûts amers que les autres (publication).

Le génotype 'sensibilité au goût amer' fait partie de la série de tests proposés par le site 23andme (analyse de votre génome pour 99 dollards).
Vous obtenez entre autre l'analyse de quelques mutations 'populaires' (résultats), mais aussi la probabilité d'avoir la maladie d'Alzheimer ou le diabète de type II (exemple de résultats)...

Les limites des tests génétiques....
Tous les individus homozygotes tt ne sentent pas le goût amer du PTC. Les individus hétérozygotes (Tt) et  homozygotes TT  devraient sentir le goût amer, mais ce n'est, dans la réalité, pas toujours le cas.
D'autres facteurs génétiques ou environnementaux encore inconnus interviennent ....

Activité 5: www.chromosomewalk.ch

 
www.chromosomewalk.ch est une exposition virtuelle pour (re)découvrir le monde des gènes, des protéines et de la bioinformatique....

Depuis la liste des chromosomes humains: rechercher 'TAS2R38'
  • Sur quel chromosome se trouve le gène TAS2R38 ?
  • Quelle est la taille de ce chromosome (nombre de nucléotide et cm) ?
  • Combien de gènes contient ce chromosome ?

Vérifiez que vous êtes de vrais experts : quiz expert !

Présentation Intro_TecDay (pdf)

Pour nous contacter...
  • outreach@sib.swiss