weebly reliable statistics

La génétique d'un goût amer...

Cet atelier de bioinformatique est un complément à l'activité PCR (sensibilité au PTC) proposée par BiOutils
(Autre protocole complet disponible en anglais (DNA Learning Center) ; protocole de l'académie de Lyon)

Historique:
Dans les années 30, le chimiste Arthur Fox synthétise le composé PTC (PhénylThioCarbamide), un composé amer produit entre autre par le brocoli.
L’un de ses collègues se plaint de l’amertume du produit alors que lui-même ne sent rien. Il est ainsi le premier à mettre en évidence la différence de sensibilité au PTC au sein de la population.

Quelques années plus tard, une étude menée par Albert Blakeslee (PNAS, 1935) a montré que l’incapacité à sentir le PTC est un trait génétique récessif (plus d'info)
 

Les individus 'sensibles' (allèle T+; homozygotes ou hétérozygotes) peuvent détecter le goût amer du PTC; les individus 'non sensibles' (allèle t-; homozygotes) ne peuvent pas détecter le goût amer du PTC .
En moyenne, 75 % des individus sont sensibles au goût amer du PTC.

C'est en 2003 seulement que le gène codant pour le récepteur au PTC, le gène TAS2R38 a été identifié (Science, 2003)
Le séquençage de ce gène a permis de mettre en évidence les variations génétiques entre individus qui sont associées au phénotype 'sensible' et 'non sensible' au PTC.

Remarque: il existe beaucoup d'autres molécules conférant un goût amer... et au moins une trentaine de gènes 'récepteurs'....
On parle ici de la génétique du goût amer de la molécule PTC, reconnue par le récepteur TAS2R38....


Activité 1: Identifier les variations génétiques associées avec la sensibilité au PTC

Environ 1 nucléotide sur 1000 diffère d'une personne à l'autre. Ces différences sont appelées variation ou mutation. La majorité d’entre elles n'ont à priori aucune conséquence, d'autre sont associées avec des maladies génétiques, d’autres encore avec des phénotypes particuliers (couleur des yeux, sensibilité au PTC,…. )

Voici les séquences ADN du gène TAS2R38 de 2 individus (t-) qui ne sont pas sensibles au PTC et de 2 individus (T+) sensibles au PTC .

>nonsensible1
     atgttgactc taactcgcat ccgcactgtg tcctatgaag tcaggagtac atttctgttt
     atttcagtcc tggagtttgc agtggggttt ctgaccaatg ccttcgtttt cttggtgaat
     ttttgggatg tagtgaagag gcaggcactg agcaacagtg attgtgtgct gctgtgtctc
     agcatcagcc ggcttttcct gcatggactg ctgttcctga gtgctatcca gcttacccac
     ttccagaagt tgagtgaacc actgaaccac agctaccaag ccatcatcat gctatggatg
     attgcaaacc aagccaacct ctggcttgct gcctgcctca gcctgcttta ctgctccaag
     ctcatccgtt tctctcacac cttcctgatc tgcttggcaa gctgggtctc caggaagatc
     tcccagatgc tcctgggtat tattctttgc tcctgcatct gcactgtcct ctgtgtttgg
     tgctttttta gcagacctca cttcacagtc acaactgtgc tattcatgaa taacaataca
     aggctcaact ggcagaataa agatctcaat ttattttatt cctttctctt ctgctatctg
     tggtctgtgc ctcctttcct attgtttctg gtttcttctg ggatgctgac tgtctccctg
     ggaaggcaca tgaggacaat gaaggtctat accagaaact ctcgtgaccc cagcctggag
     gcccacatta aagccctcaa gtctcttgtc tcctttttct gcttctttgt gatatcatcc
     tgtgttgcct tcatctctgt gcccctactg attctgtggc gcgacaaaat aggggtgatg
     gtttgtgttg ggataatggc agcttgtccc tctgggcatg cagccatcct gatctcaggc
     aatgccaagt tgaggagagc tgtgatgacc attctgctct gggctcagag cagcctgaag
     gtaagagccg accacaaggc agattcccgg acactgtgtt ga

>nonsensible2
     atgttgactc taactcgcat ccgcactgtg tcctatgaag tcaggagtac atttctgttc
     atttcagtcc tggagtttgc agtggggttt ctgaccaatg ccttcgtttt cttggtgaat
     ttttgggatg tagtgaagag gcaggcactg agcaacagtg attgtgtgct gctgtgtctc
     agcatcagcc ggcttttcct gcatggactg ctgttcctga gtgctatcca gcttacccac
     ttccagaagt tgagtgaacc actgaaccac agctaccaag ccatcatcat gctatggatg
     attgcaaacc aagccaacct ctggcttgct gcctgcctca gcctgcttta ctgctccaag
     ctcatccgtt tctctcacac cttcctgatc tgcttggcaa gctgggtctc caggaagatc
     tcccagatgc tcctgggtat tattctttgc tcctgcatct gcactgtcct ctgtgtttgg
     tgctttttta gcagacctca cttcacagtc acaactgtgc tattcatgaa taacaataca
     aggctcaact ggcagaataa agatctcaat ttattttatt cctttctctt ctgctatctg
     tggtcagtgc ctcctttcct attgtttctg gtttcttctg ggatgctgac tgtctccctg
     ggaaggcaca tgaggacaat gaaggtctat accagaaact ctcgtgaccc cagcctggag
     gcccacatta aagccctcaa gtctcttgtc tcctttttct gcttctttgt gatatcatcc
     tgtgttgcct tcatctctgt gcccctactg attctgtggc gcgacaaaat aggggtgatg
     gtttgtgttg ggataatggc agcttgtccc tctgggcatg cagccatcct gatctcaggc
     aatgccaagt tgaggagagc tgtgatgacc attctgctct gggctcagag cagcctgaag
     gtcagagccg accacaaggc agattcccgg acactgtgct ga

>sensible1
     atgttgactc taactcgcat ccgcactgtg tcctatgaag tcaggagtac atttctgttc
     atttcagtcc tggagtttgc agtggggttt ctgaccaatg ccttcgtttt cttggtgaat
     ttttgggatg tagtgaagag gcagccactg agcaacagtg attgtgtgct gctgtgtctc
     agcatcagcc ggcttttcct gcatggactg ctgttcctga gtgctatcca gcttacccac
     ttccagaagt tgagtgaacc actgaaccac agctaccaag ccatcatcat gctatggatg
     attgcaaacc aagccaacct ctggcttgct gcctgcctca gcctgcttta ctgctccaag
     ctcatccgtt tctctcacac cttcctgatc tgcttggcaa gctgggtctc caggaagatc
     tcccagatgc tcctgggtat tattctttgc tcctgcatct gcactgtcct ctgtgtttgg
     tgctttttta gcagacctca cttcacagtc acaactgtgc tattcatgaa taacaataca
     aggctcaact ggcagaataa agatctcaat ttattttatt cctttctctt ctgctatctg
     tggtctgtgc ctcctttcct attgtttctg gtttcttctg ggatgctgac tgtctccctg
     ggaaggcaca tgaggacaat gaaggtctat accagaaact ctcgtgaccc cagcctggag
     gcccacatta aagccctcaa gtctcttgtc tcctttttct gcttctttgt gatatcatcc
     tgtgctgcct tcatctctgt gcccctactg attctgtggc gcgacaaaat aggggtgatg
     gtttgtgttg ggataatggc agcttgtccc tctgggcatg cagccgtcct gatctcaggc
     aatgccaagt tgaggagagc tgtgatgacc attctgctct gggctcagag cagcctgaag
     gtcagagccg accacaaggc agattcccgg acactgtgct ga

>sensible2
     atgttgactc taactcgcat ccgcactgtg tcctatgaag tcaggagtac atttctgttc
     atttcagtcc tggagtttgc agtggggttt ctgaccaatg ccttcgtttt cttggtgaat
     ttttgggatg tagtgaagag gcagccactg agcaacagtg attgtgtgct gctgtgtctc
     agcatcagcc ggcttttcct gcatggactg ctgttcctga gtgctatcca gcttacccac
     ttccagaagt tgagtgaacc actgaaccac agctaccaag ccatcatcat gctatggatg
     attgcaaacc aagccaacct ctggcttgct gcctgcctca gcctgcttta ctgctccaag
     ctcatccgtt tctctcacac cttcctgatc tgcttggcaa gctgggtctc caggaagatc
     tcccagatgc tcctgggtat tattctttgc tcctgcatct gcactgtcct ctgtgtttgg
     tgctttttta gcagacctca cttcacagtc acaactgtgc tattcatgaa taacaataca
     aggctcaact ggcagaataa agatctcaat ttattttatt cctttctctt ctgctatctg
     tggtctgtgc ctcctttcct attgtttctg gtttcttctg ggatgctgac tgtctccctg
     ggaaggcaca tgaggacaat gaaggtctat accagaaact ctcgtgaccc cagcctggag
     gcccacatta aagccctcaa gtctcttgtc tcctttttct gcttctttgt gatatcatcc
     tgtgctgcct tcatctctgt gcccctactg attctgtggc gcgacaaaat aggggtgatg
     gtttgtgttg ggataatggc agcttgtccc tctgggcatg cagccgtcct gatctcaggc
     aatgccaagt tgaggagagc tgtgatgacc attctgctct gggctcagag cagcctgaag
     gtaagagccg accacaaggc agattcccgg acactgtgct ga


Comparer ces 4 séquences et localiser les variations associées avec la sensibilité au PTC

...vous pourriez le faire manuellement (pour les plus motivés, courage...)

Approche bioinformatique:
Construire un alignement des 4 séquences à l'aide d'un outil bioinformatique et identifier les variations communes aux personnes insensibles au PTC

* Copier/Coller les 4 séquences (inclue la ligne '>') dans l'outil d'alignement d'UniProt
* Cliquer sur l'icône 'align'
* Dans la colonne de droite: sélectionner 'Similarity'.

Résultats de l'alignement

Interprétation des résultats et conclusion

Pour aller plus loin....
Répartition de la variation 145 g -> c (appelée 'SNP rs713598') dans la population humaine (cliquer sur 'Google map')


Activité 2: Ces variations modifient la séquence de la protéine ?

Le récepteur TAS2R38, comme toutes les protéines, est composé d'une succession d'acides aminés (Il existe 20 acides aminés différents (pdf); (plus d'info))
L'ordre des acides aminés dans la séquence de la protéine est déterminé par la séquence en acide nucléique du gène correspondant:
3 'lettres ADN' (un codon) correspondent à 1 'lettre acide aminé' selon le code génétique.

Voici les séquences ADN du gène TAS2R38 dans la région des variations.
Position 145
Sensible: cag cca ctg
  Non sensible: cag gca ctg

Position 785
Sensible: tgt gct gcc
  Non sensible: tgt gtt gcc

Position 886
Sensible: gcc gtc ctg
  Non sensible: gcc atc ctg
  • Est-ce que les variations modifient la séquence en acide aminé de TAS2R38 ?
  • Est-ce que la variation  tgt -> tgc (qui n'est pas associée à la sensibilité au PTC)  modifie la séquence en acide aminé de TAS2R38 ?

Vous pourriez traduire manuellement les séquences en utilisant le code génétique  

Vous pouvez utiliser l'outil bioinformatique 'Translate'
(ne garder que le résultat du 'Frame 1')

Réponse: les 3 variations qui modifient le phénotype 'sensibilité au PTC' conduisent à un changement d'acide aminé dans la séquence de la protéine TAS2R38 (résultats)

Et pour finir...
Traduire le gène de l'individu 'nonsensible2' et de l'individu 'sensible1' et comparer les 2 séquences de protéines...

* Copier/coller les 2 séquences ADN (inclue la ligne '>') dans l'outil 'EMBOSS Transeq'; cliquer sur le bouton vert 'submit'
* Copier/coller les 2 séquences traduites (inclue la ligne '>') dans l'outil d'alignement d'UniProt
   !!!!! enlever le signe '*' qui se trouve à la fin des 2 séquences....
* Cliquer sur l'icône 'align'
* Dans la colonne de droite: sélectionner 'Similarity'.

Réponse: les 3 variations qui modifient le phénotype 'sensibilité au PTC' conduisent à un changement d'acide aminé dans la séquence de la protéine TAS2R38 (résultats)

Activité 3: Ces variations modifient la structure de la protéine ?

Petit rappel: de la séquence d'une protéines à sa structure 3D (pdf)





Un programme bioinformatique permet de 'visualiser' le modèle en 3D et la localisation des 3 variants:
Depuis ce lien
    - Dans la section 'Model' cliquer sur 'show', puis sur 'Display' (vous avez besoin de Java)
   
- Une fois la structure 3D visible: cliquer sur 'Natural variant' 49, 262, 296 (résultats)
Selon ce modèle, les 3 variations sont localisées proches du site de liaison du PTC: elles empêchent le PTC d'interagir avec le récepteur TAS2R38 (publication).

Activité 4: Sur quel chromosome est localisé le gène TAS2R38 ?

Voici 2 séquences ADN du gène TAS2R38 (nb: il s'agit des 2 primers utilisés pour la PCR BiOutils)
    Primer forward: ccttcgttttcttggtgaatttttgggatgtagtgaagaggcgg
    Primer reverse: aggttggcttggtttgcaatcatc
    
Approche bioinformatique: Utiliser l'outil 'BLAT'

Info technique: 'BLAT' est un outil bioinformatique qui permet de comparer une séquence ADN avec la séquence d'un génome entier (soit un texte de 3 milliards de nucléotides pour le génome humain) et de retrouver, si elle existe, celle qui lui ressemble le plus, en quelques secondes. C'est un peu le 'google map' du génome humain

* Copier/coller la séquence ADN dans l'outil 'BLAT'
* Cliquer sur 'submit'
* Page 'BLAT Search Result': Choisir le meilleur score (un match qui couvre la séquence en entier) et cliquer sur 'browser'

  • Sur quel chromosome sont localisés les primers ? Dans quel gène ?
  • Quelles sont les positions de la séquence sur le chromosome ('numéro' des nucléotides) ? 

  • Amusez-vous à 'écrire' une séquence au hasard (d'environ 30 lettres), toujours avec un alphabet de 4 lettres (a,t,g,c) dans 'BLAT' : la retrouvez-vous dans notre génome ?

Activité 5: TAS2R38 est-il spécifique à l'être humain ?


Voici la séquence en acide aminé de la protéine TAS2R38 humaine
MLTLTRIRTVSYEVRSTFLFISVLEFAVGFLTNAFVFLVNFWDVVKRQALSNSDCVLLCL
SISRLFLHGLLFLSAIQLTHFQKLSEPLNHSYQAIIMLWMIANQANLWLAACLSLLYCSK
LIRFSHTFLICLASWVSRKISQMLLGIILCSCICTVLCVWCFFSRPHFTVTTVLFMNNNT
RLNWQIKDLNLFYSFLFCYLWSVPPFLLFLVSSGMLTVSLGRHMRTMKVYTRNSRDPSLE
AHIKALKSLVSFFCFFVISSCAAFISVPLLILWRDKIGVMVCVGIMAACPSGHAAILISG
NAKLRRAVMTILLWAQSSLKVRADHKADSRTLC

Question:

  • Cette protéine est-elle spécifique à l'être humain ?

Approche bioinformatique:
Faire un 'BLAST' contre une banque de données de protéines appelée UniProtKB/Swiss-Prot


Info technique: BLAST est un outil bioinformatique qui permet de comparer la séquence d'une protéine avec des millions d'autres séquences contenues dans les banques de données et de retrouver, si elles existent, celles qui lui ressemblent le plus, en quelques secondes. On peut ainsi rapidement savoir si une protéine existe dans une espèce donnée.

* Copier/coller la séquence dans l'outil 'BLAST'
* Sélectionner 'Database = UniProtKB/Swiss-Prot'
* Cliquer sur le bouton 'BLAST'
* Rechercher les images correspondant au nom latin des différentes espèces sur Google

Question:

  • Les autres animaux perçoivent-ils le goût amer du PTC ?

Approche bioinformatique:
Depuis la page du résultat du BLAST précédent:

* Cocher/Sélectionner les séquences 'T2R38_' (= la protéine T2R38 chez les autres espèces)
* Dans le bandeau vert qui apparaît en bas de la page: cliquer sur 'Align'
* Dans la colonne de droite 'Annotation': sélectionner 'Natural variant'
* Est-ce que les autres animaux perçoivent le goût amer du PTC ?
Remarque: les séquences de protéines présentes dans la banque de données UniProtKB/Swiss-Prot sont les séquences les plus fréquentes dans la population (avec les variations les plus fréquentes)

Le goût amer et l'évolution....

  • Les herbivores doivent pouvoir manger un maximum de végétaux différents, même les plus amers. Ils sont de façon générale moins sensibles au goût amer que les omnivores: ils possèdent moins de gènes 'sensibles' à l'amertume....
  • Il semblerait que le chimpanzé soit sensible au goût amer du PTC....
  • Il semblerait que l'on retrouve plus d'individus sensibles au goût amer parmi les non fumeurs....
  • Une étude récente a montré que les adolescents en surpoids sont généralement  moins sensibles aux différents goûts amers que les autres (publication).

Le génotype 'sensibilité au goût amer' fait partie de la série de tests proposés par le site 23andme (analyse de votre génome pour 99 dollards).
Vous obtenez entre autre l'analyse de quelques mutations 'populaires' (résultats), mais aussi la probabilité d'avoir la maladie d'Alzheimer ou le diabète de type II (exemple de résultats)...

Les limites des tests génétiques....
Tous les individus homozygotes tt ne sentent pas le goût amer du PTC. Les individus hétérozygotes (Tt) et  homozygotes TT  devraient sentir le goût amer, mais ce n'est, dans la réalité, pas toujours le cas.
D'autres facteurs génétiques ou environnementaux encore inconnus interviennent ....

Activité 6: www.chromosomewalk.ch

 
www.chromosomewalk.ch est une exposition virtuelle pour (re)découvrir le monde des gènes, des protéines et de la bioinformatique....

Depuis la liste des chromosomes humains: rechercher 'TAS2R38'
  • Sur quel chromosome se trouve le gène TAS2R38 ?
  • Quelle est la taille de ce chromosome (nombre de nucléotide et cm) ?
  • Combien de gènes contient ce chromosome ?

Vérifiez que vous êtes de vrais experts : quiz expert !

Pour nous contacter...
  • sp-com@isb-sib.ch