Atelier 3b - La pizza métagénomique*...

Publication (EN) ou ici

1- La biodiversité d'une pizza

Essayez de deviner combien d'espèces différentes sont présentes dans une pizza  !

 

Au cas où, n'hésitez pas à parcourir la recette de notre pizza (version pdf) .


Le but de cet atelier est d'identifier les espèces présentes dans une pizza grâce à leur ADN.

Petit rappel (voir aussi Atelier 1)....

2- Des espèces, des cellules et des chromosomes...

Tous les êtres vivants sont constitués de cellule(s).

Chaque cellule contient un ou plusieurs chromosomes:

Liste des plantes dont le 'caryotype informatisé' est disponible / Liste de tous les organismes.

3- L'ADN est universel....

Un chromosome peut être comparé à une pelote dont le fil est l'ADN
 
L'ADN est une succession de 4 molécules - les 4 nucléotides (adénine, thymine, guanine, cytosine) - liées entre elles dans un ordre bien défini...
Les 4 nucléotides sont symbolisés par les lettres A, T, G et C.

Remarque: l'ADN est 'double brin': le A est toujours en face d'un T - le C toujours en face d'un G.

Une photo de l'ADN vu au microscope électronique

4- L'ADN peut être séquencé....

On peut ainsi déterminer l’ordre dans lequel se succèdent les 4 nucléotides A, T, G et C:
tttaaaaccaacaacgtgaccgcgcgcctgtttgaacgcca....

Remarque: Une séquence d'ADN est représentée sous la forme 'simple brin': on parle alors de 'bases' (ou de 'nucléotides') et non plus de 'paires de bases'

Exemple: l'ADN de la bactérie Escherichia coli  (4'646'332 nucléotides)

Il est aujourd’hui possible d’extraire l’ADN d’un échantillon biologique contenant plusieurs espèces  (une pizza par exemple..) ...
...et de le ‘séquencer’: c'est ce qu'on appelle la métagénomique*

5- C'est à qui ?

Comment savoir à quelle espèces appartient un morceau d'ADN extrait d'un échantillon biologique ?
L’ordre dans lequel se succèdent les 4 nucléotides (la séquence ADN) est le plus souvent spécifique à une espèce.
La séquence ADN permet d'identifier l'espèce: pour cela il faut la comparer avec les séquences contenues dans une banque de données.

!!!! Une différence peut faire toute la différence…

 

5- A vous de jouer !

Voici la séquence d'un morceau d'ADN extrait de la pizza...
tttaaaaccaacaacgtgaccgcgcgcctgtttgaacgcca

Approche bioinformatique 'manuelle'


Comparer manuellement la séquence ADN ci-dessus avec les séquences qui se trouvent dans ces fiches (banque de données 'papier')
Trucs: Les séquences ADN sont classées dans l'ordre alphabétique
...

Approche bioinformatique 'pour de vrai'

La séquence d’ADN peut être comparée avec les 50’000’000 de séquences (fiches) contenues dans une banque de données informatisée (UniProtKB)

Conclusion:
1- la séquence ADN inconnue appartient à la tomate


2-  la séquence ADN inconnue 'code' pour une protéine appelée: 'Light-mediated development protein DET1', une protéine impliquée dans la fabrication des pigments de la tomate...

Remarque pour les plus curieux: le programme Blast a d'abord traduit la séquence ADN en séquence de protéine (acide aminé) avant de faire la recherche sur la banque de données UniProtKB/Swiss-Prot !

D'autres séquences à identifier:
agcgataaaaaaagcctgatgccgctggtgggcattccggg   
aactttagcaaaaacctgccgctgctggtgagcctgtgggc 
accaccagccagctgcatattgcgtttctggcgtttccgtt 
agcgaaattaccctgggcaaatatctgtttgaacgcctgaa 
et plus encore....


6- Classer vos séquences ADN sur un arbre phylogénétique

Différents arbres sont disponibles dans ce fichier (version pdf)
Arbre de la vie (BiOutil) (html)

A  new view of the  tree of life: Publication (2016)

7- Le DNA barcoding: 'a genetic inventory of biodiversity'

Sans le savoir vous avez utilisé une approche de 'DNA barcoding'.
Le DNA barcoding a pour but d'avoir pour chaque espèce une séquence ADN (environ 500 à 600 nucléotides) qui lui est spécifique et qui permet de l'identifier (un peu comme un code bare).
Les séquences ADN utilisées pour ce projet sont dérivées des gènes COX1 pour les animaux et rbcL et matK pour les plantes.

Il existe un projet international dont le but est de répertorier toutes les espèces présentes sur notre planète et d'avoir pour chacune d'entre elles, une (ou plusieurs) séquence ADN qui lui est spécifique.

* métagénomique: ce terme un peu barbare signifie qu'au lieu de séquencer l'ADN d'une seule espèce (génome), les scientifiques séquencent maintenant à l'ADN contenu dans un échantillon biologique, provenant donc de plusieurs espèces (métagénome): l'eau de mer (1 million de bactéries, 10 million de virus dans 1 ml...), une baleine en décomposition au fond des océans, l'air de New-York, matières fécales (contenant des centaines d'espèces de bactéries différentes)....ou une pizza (pas trop cuite...)

« Pompéi microbiologique» dans le tartre dentaire - métagénomique du tartre dentaire: des chercheurs ont étudié l'ADN présent dans le tartre des dents de squelettes humains vieux de 1000 ans (Dalheim, Allemagne; 950–1200). Ils ont ainsi pu identifer des restes de blé, de porc, probablement du mouton, du chou et un certain nombre de bactéries (dont certaines pathogènes, responsables de la parondotose) qui sont toujours présentes dans notre cavité buccale (Publication). Plus de 2000 bactéries sont présentes dans notre cavité buccale. La flore buccale a donc être 'capturée et fossilisée', tout comme l'ont été les victimes de Pompéi .


Pour nous contacter...

Cet atelier fait partie des kits proposés par (R)amène ta science (Faculté des Sciences, UNIGE)