Atelier - La pizza métagénomique*...

* métagénomique: ce terme un peu exotique signifie simplement qu'au lieu d'analyser l'ADN d'une seule espèce (génome), les scientifiques analysent  l'ADN d'un échantillon biologique, contenant de plusieurs espèces (métagénome)...

Mise à jour: mars 2018

Le but de cet atelier est d'identifier les espèces présentes dans une pizza grâce à leur ADN ...

... et de découvrir l'utilité de la banque de données UniProtKB/Swiss-Prot !

Cet atelier a fait l'objet d'une publication (en anglais)


1- La biodiversité d'une pizza

Essayez de deviner combien d'espèces différentes sont présentes dans une pizza  !

Ne pas confondre 'ingrédient' et 'espèce': la farine (ingrédient) est extraite du blé (espèce) !

 

Au cas où, n'hésitez pas à parcourir la recette de notre pizza (version pdf) .

Estimation: il pourrait y avoir jusqu'à 50 espèces différentes selon l'imagination et l'hygiène du cuisinier (pizza marinière, pizza végétarienne, pizza fungi, pizza au nutella, etc..) !

2- Des organismes, des cellules et des chromosomes...

Petit rappel (voir aussi Atelier 1)....

Tous les êtres vivants sont constitués de cellule(s).


Chaque cellule contient un ou plusieurs chromosomes:

Liste des plantes dont le 'caryotype informatisé' est disponible / Liste de tous les organismes.

3- L'ADN est universel...


Un chromosome peut être comparé à une pelote dont le fil est l'ADN
 
L'ADN est une succession de 4 molécules - les 4 nucléotides (adénine, thymine, guanine, cytosine) - liées entre elles dans un ordre bien défini...
Les 4 nucléotides (ou bases) sont symbolisés par les lettres A, T, G et C.

Remarque: l'ADN est 'double brin': le A est toujours en face d'un T - le C toujours en face d'un G. On parle de 'paires de bases'

Une photo de l'ADN vu au microscope électronique

4- L'ADN peut être séquencé...

On peut ainsi déterminer l’ordre dans lequel se succèdent les 4 nucléotides A, T, G et C:
tttaaaaccaacaacgtgaccgcgcgcctgtttgaacgcca....

Remarque: Une séquence d'ADN est représentée sous la forme 'simple brin': on parle alors de 'bases' (ou de 'nucléotides') et non plus de 'paires de bases'

Exemple: l'ADN de la bactérie Escherichia coli  (4'646'332 nucléotides) ou l'ADN du chromosome 1 de la tomate

Il est également possible d’extraire l’ADN d’un échantillon biologique contenant plusieurs espèces  (une pizza pas trop cuite par exemple..) ...
...et de le ‘séquencer’: c'est ce qu'on appelle la métagénomique

5- C'est à qui ?

Comment savoir à quelle espèces appartient un morceau d'ADN extrait d'un échantillon biologique ?

L’ordre dans lequel se succèdent les 4 nucléotides (la séquence ADN) est le plus souvent spécifique à une espèce.
La séquence ADN permet d'identifier l'espèce: pour cela il faut la comparer avec les séquences contenues dans une banque de données.

!!!! Une différence peut faire toute la différence…

 

6- A vous de jouer !

Voici la séquence d'un morceau d'ADN extrait de la pizza...
tttaaaaccaacaacgtgaccgcgcgcctgtttgaacgcca

(1) Approche bioinformatique 'manuelle'


Comparer manuellement la séquence ADN ci-dessus avec les séquences qui se trouvent dans la banque de données 'papier'  (pdf)

Trucs: Les séquences ADN sont classées dans l'ordre alphabétique
...




Conclusion de l'analyse manuelle: la séquence ADN 
tttaaaaccaacaacgtgaccgcgcgcctgtttgaacgcca
provient de la tomate....


(2) Approche bioinformatique 'pour de vrai' (BLAST)

La séquence d’ADN peut être comparée avec les 550’000 séquences (fiches) contenues dans une banque de données informatisée (UniProtKB/Swiss-Prot)

Conclusion:

1- la séquence ADN inconnue appartient à la tomate


2-  la séquence ADN inconnue 'code' pour une protéine appelée: 'Light-mediated development protein DET1', une protéine impliquée dans la fabrication des pigments de la tomate...

Remarque pour les plus curieux: le programme Blast a d'abord traduit la séquence ADN en séquence de protéine (acide aminé) avant de faire la recherche sur la banque de données UniProtKB/Swiss-Prot !


D'autres séquences à identifier:
agcgataaaaaaagcctgatgccgctggtgggcattccggg   
aactttagcaaaaacctgccgctgctggtgagcctgtgggc 
accaccagccagctgcatattgcgtttctggcgtttccgtt 
agcgaaattaccctgggcaaatatctgtttgaacgcctgaa 
et plus encore....  

7- Classer les séquences ADN sur un arbre phylogénétique

L'ADN est universel. Vous pouvez classer les différentes séquences ADN sur  un arbre de la vie.

Différents arbres peuvent être imprimés: Arbre 1 (version pdf) ou Arbre de la vie (BiOutil) (html)



A new view of the  tree of life: Publication (2016)

8- Quelques analyses métagénomiques

Des analyses de différents échantillons biologiques sont en cours:
- ADN extrait de l'eau de la mer des Sargasses (1 ml d'eau de mer contient 1 million de bactéries et 10 million de virus...)
- ADN extrait d'une baleine en décomposition au fond des océans (Pacific Ocean (depth=1674 meters), Santa Cruz Basin (N33.30 W119.22) )
- l'air ambiant de 2 centres commerciaux à Singapour  (publication)
- ADN extrait de matières fécales (contenant des centaines d'espèces de bactéries différentes)

Mais encore:

- «Pompéi microbiologique» dans le tartre dentaire - métagénomique du tartre dentaire
Des chercheurs ont étudié l'ADN présent dans le tartre des dents de squelettes humains vieux de 1000 ans (Dalheim, Allemagne; 950–1200).
Ils ont ainsi pu identifer des restes de blé, de porc, probablement du mouton, du chou et un certain nombre de bactéries (dont certaines pathogènes, responsables de la parondotose) qui sont toujours présentes dans notre cavité buccale, malgré les antibiotiques et une hygiène très différente (publication).
Plus de 2000 bactéries sont présentes dans notre cavité buccale. La flore buccale a donc être 'capturée et fossilisée', tout comme l'ont été les victimes de Pompéi .

9- Le DNA barcoding: 'a genetic inventory of biodiversity'

Le DNA barcoding a pour but d'avoir pour chaque espèce une séquence ADN (environ 500 à 600 nucléotides) qui lui est spécifique et qui permet de l'identifier (un peu comme un code bare).
Les séquences ADN utilisées pour ce projet sont dérivées des gènes COX1 pour les animaux et rbcL et matK pour les plantes.

Il existe un projet international dont le but est de répertorier toutes les espèces présentes sur notre planète et d'avoir pour chacune d'entre elles, une (ou plusieurs) séquence ADN qui lui est spécifique.

Pour nous contacter...

BONUS

- Vous reprendrez bien un peu de cheval dans vos lasagnes ? (chronologie d'une affaire qui a inspiré cet atelier...)

- Cet atelier fait partie des kits proposés par (R)amène ta science (Faculté des Sciences, UNIGE)
- Cet atelier a fait l'objet d'une publication (en anglais)
- La recette taxonomique d'une pizza (en anglais)
- La pizza métagénomique à l'émission RTS  CQFD (8 mars 2018)  ( mp3 ) (Avis d'experts)


- Vous pouvez suivre nos activités sur Facebook