weebly reliable statistics

Le génome humain, mon cousin et moi...

Mise à jour: mars 2017 (certaines données ou résultats peuvent changer à chaque nouvelle version des génomes)
Bioinformatique: découverte d'un Genome Browser et de l'outil BLAT (UCSC).

Nous sommes constitués de quelques 100’000 milliards de cellules (neurones, cellules de la peau, cellules du foie, …).
Chaque cellule abrite 23 paires de chromosomes (caryotype informatisé)

Chaque chromosome peut être comparé à une petite pelote dont le fil est l’ADN.
Ce fil d’ADN est constitué d’une succession de 4 nucléotides, appelés a, t, g, c.  (de la cellule à l'ADN...(pdf) )

Il est possible de 'séquencer l'ADN',  c'est-à-dire de connaître l'ordre dans lequel s'enchaînent les 4 nucléotides pour chaque chromosome.


Les 3 milliards de nucléotides répartis sur nos 23 chromosomes constituent notre génome.

Chaque espèce possède une séquence ADN dite de référence (un génome de référence) qui est disponible en ligne et accessibles grâce à des outils bioinformatiques, comme les 'genome browser', qui permettent  de  'naviguer dans les génomes'.

Le génome humain de référence (GRCh) est une séquence ADN 'consensus' construite à partir des séquences ADN de plusieurs individus anonymes.

Le chromosome 21 est l'un des plus petits chromosomes humains: 1.6 cm d'ADN, quelques 48'000'000 de nucléotides.
Nous avons imprimé les 48 millions de nucléotides du chromosome 21 (génome de référence) dans un livre de 1470 pages !

ExpandingYourHorizon


Activité 1: sur quel chromosome est localisée une séquence ADN ?


Voici une photo d'une des 1470 pages du livre 'Chromosome 21':





Depuis le site genome.ucsc.edu (BLAT)
BLAT est un outil bioinformatique qui permet de 'naviguer dans les génomes' (Genome Browser)....




Note 1: certaines séquences ADN peuvent se retrouver sur plusieurs chromosomes différents (région répétée, dupliquée, etc.).
Note 2: les bandes chromosomiques sont des régions  des  chromosomes que l'on distingue grâce à des colorations spécifiques. Elles correspondent à des positions nucléotidiques bien précises.

Activité 2: si on introduisait  des erreurs dans une séquence ADN...

Depuis le site genome.ucsc.edu (BLAT)


Activité 3: mon génome à moi...


Voici un morceau de la séquence ADN du gène codant pour l'insuline humaine.
Note: il  s'agit de la séquence ADN 'personelle' de Craig Venter...

 tccagctggt agagggagca gatgctggta cagcattgtt ccacaatgcc acgcttctgc
 agggacccct ccagggccaa gggctgcagg ctgcctgcac cagggccccc gcccagctcc
 acctgcccca ctgccaggac gtgccgcgca gagcaggttc cggaacagcg gcgaggcaga
 gggacacagg aggacacagt cagggagaca cagtgcccgc ctgcccgcca gccctaggtc
 gcactcccac ccatctccag ccgggctgga cccaggttag agggagggtc acccacagtg
 ggtgtggacc tacaggcccc aacgcccaca tgtcccacct ccttcccccg ccccggggca
 gcgtcacagt gggagcctga acaggtgatc ccagtacttc tccccagggc ctgtccccag
 catcttcccc atctcctgac tatggagctg ccgtgaggcc tggcgacagg ggtctggccc
 actcaggcag gcagccacgc cctcctccgg gcgtgatggg gtgttcgccc agaggcaggc

Depuis le site genome.ucsc.edu (BLAT)


Activité 4: conservation d'une séquence ADN dans le génome de différents primates

Depuis le site genome.ucsc.edu (BLAT)



Activité 5: de l'ADN de l'homme de Néandertal en nous ?

Voici la séquence du génome de la mitochondrie de Homo sapiens neanderthalensis
Copier un morceau de séquence ADN (environ 30 nucléotides), par exemple: gtgagttcaccctctaaatcaccacgatcaaaagggacaagcatc

Depuis le site genome.ucsc.edu (BLAT)


Activité 6: la séquence ADN qui permet de déterminer le sexe d'un individu

Depuis le site genome.ucsc.edu (BLAT)


Activité 7: retrouve-t-on une séquence ADN 'écrite' au hasard ?


Depuis le site genome.ucsc.edu (BLAT)


Activité 8: visiter notre Genome Browser version grand public...


Pour aller plus loin:


...si vous souhaitez acquérir le livre Chromosome 21, qui contient toute la séquence ADN du chromosome 21 humain
(48 millions de nucléotides, 1470 pages), n'hésitez pas à nous contacter: info(at)sib.swiss

Licence et mentions légales

Creative Commons License